viernes, 13 de diciembre de 2019

Aprendiendo a identificar Sistemas CRISPR (III)

Si ya hemos practicado un poco con las secuencias anteriores, deberíamos entender que una secuencia de nucleótidos precisa tiene un gran valor identificativo. Por ello, podemos deducir que gran parte del manejo del programa (Clonemanger) se basa en buscar secuencias concretas, alinearlas de manera parecida, etc.  Y esas son herramientas que nos ayudarán a definir y entender cómo se logra encontrar un sistema CRISPR en una secuencia de nucleótidos,  que como todos sabemos se trata de:  
“Clustered Regularly Interspaced Short Palindromic Repeats” 

O sea, grupos de secuencias cortas (20-40 nt) repetidas generalmente palindrómicas interespaciadas de manera regular (a distancias entre 30-70 nt).

Recordando, atendiendo y practicando las explicaciones del pasado Jueves 5 de Diciembre

Para identificar de manera rápida este tipo de “estructuras” en una secuencia de DNA existe una página web denominada: crispr finder (https://crispr.i2bc.paris-saclay.fr/Server/). Os animo a que entréis:

Y subáis el documento que tenéis en la carpeta 2-E coli denominado E coli.txt (que “pesa” 4596 KB). Y “clickeis” en Find crispr
Os debe de salir algo así: 


Que debemos saber (y recordar) qué significan:


Con esta información deberíamos de saber, crear y modificar un documento de clone manager. De tal manera que partiendo de:
Una secuencia de este tipo:
 La convirtamos inicialmente en una secuencia de este tipo: 
Para ello habrá que utilizar la herramienta add feature seleccionando en cada caso la secuencia que queremos “dibujar”. En este caso deberéis de ayudar a los que no estuvieron, y hacer un poco de memoria de cómo lo hicimos ese Jueves, clave!!! … (consultar el tutorial del programa por si sirve de ayuda, usad el blog, cargarlo de preguntas, etc… ).


Finalmente, acompañando a estos sistemas repetidos, casi siempre se encuentran grupos de genes asociados, los denominados genes “Cas”. El clone manager nos va a permitir identificarlos, “dibujarlos”, definirlos y en resumen entender en qué consisten. 

Se trata de que debemos de convertir esta información:

En esta otra:

Donde se identifican los marcos abiertos de lectura (ORFs) que codifican las proteínas que acompañan el elemento CRISPR (con 13 repeticiones directas) y que hacen funcional todo un sistema de defensa inmune en bacterias.

Es sólo (y no tan sólo, soy consciente) de ponernos un rato y “entender” toda la información extraíble de una mera secuencia de cuatro letras: la A, la T, la C y la G… .
Ánimo que veréis como podéis (podemos). Activemos el blog con comentarios/preguntas, que estoy seguro que no sólo hay una sino mil….
Ya tenemos tarea!!!!...

jueves, 12 de diciembre de 2019

Aprendiendo a identificar Sistemas CRISPR (II)

Ya hemos dado nuestros primeros pasos con el programa Clonemanager (podemos encontrar más información sobre su manejo en los tutoriales que se encuentran en la carpeta del programa: S8Guide1 y S8Guide2). Hemos entendido que la información del DNA se basa en un código de 4 letras (GATC) y que esa secuencia, tiene un gran valor identificativo. Pero …, sabemos que esa secuencia “esconde” genes. (ver las presentaciones en recursos). 
Y es que, los genes al final de cuentas son en su mayoría proteínas, esto es secuencias de aminoácidos. Además gracias al código genético universal, tener una secuencia de nucleótidos (GATC…) es equivalente a tener una secuencia de aminoácidos, o sea un gen.


El código genético Universal

Todos tenemos que tener un ruleta parecida… (La tenemos, verdad??) en la que como vemos los aminoácidos están codificados en tripletes de nucleótidos… 
Os propongo un ejercicio que no es otro que me digáis las 6 secuencias de aminoácidos codificados en estos 20 nucleótidos:
ATGTACGTAATACTGGTATA

“Un premio al que lo diga primero en comentarios (podeis consultarlo ente vosotros…)”. Y lo incluís en comentarios de este Blog!!! Mejor Hoy que mañana!!!”

Podéis hacerlo en un cuaderno usando la plantilla y ruleta. Es un buen ejercicio, pero si recordáis un poco (o consultáis con los que estuvieron), la herramienta Clonemanager os puede ayudar en la tarea. Desde varias opciones:
(i) Usando la herramienta format y cambiando la información de secuencia de manera que incluya la traducción (translate) de la secuencia de DNA…

(ii) Usando la herramienta “Process molecule” y traduciendo…

Porque el programa nos permite identificar lo que se conoce como marcos abiertos de lectura (en ingles Open Reading Frame; lo recordáis, os suena, etc….
Os recomiendo el nuevo ejercicio:
“Abrid desde el clone manager el Archivo 1-20 kb dentro de la carpeta de ejercicios:  3-ORF”.
Tenéis que entender cómo el programa ha encontrado esos Marcos Abiertos de Lectura (ORFs) mediante la herramienta ORF search:

Encontrando al menos 7 marcos abiertos de lectura que “codifican a 7 secuencias de proteína respectivas.

¿Quién me dice el número de aminoácidos de cada uno de ellas (la más grande, la más chica, … (el listado de todas ellas…)?

¡¡¡Quiero el blog lleno de dudas, comentarios, etc...!!!

Tras estos ejercicios y un poco de práctica estamos ya preparados para “enfrentarnos a la identificación de los sistemas CRISPR.
Aupa Team, estamos en la senda!!! 

martes, 10 de diciembre de 2019

Aprendiendo a identificar los Sistemas CRISPR (I)

Ya estamos en el camino de convertirnos en unos expertos buscadores de sistemas CRISPR en los  genomas de bacterias… ¿O no?

Caras sonrientes de alumnos y algún padre (Pedro y Raúl) tras la dura sesión del pasado Jueves.

Parece fácil, una vez lo conoces, parece evidente…  Pero, no hay que olvidar que lo que hicimos el pasado Jueves en una sesión de unas 3 h les llevo a los investigadores casi 10 años caer en la cuenta de lo que estaban analizando (os animo a que le echéis un vistazo a este artículo subido en recursos: Mojica FJ, Rodriguez-Valera F. The discovery of CRISPR in archaea and bacteria. FEBS J. 2016 Sep; 283(17):3162-9); (Ver imagen 2).  Seamos conscientes de ello. 



Qué fue lo que hicimos exactamente:
Lo primero fue recordar y ya centrarnos en los objetivos de nuestro proyecto (ver presentación 2º dia en recursos) que aunque se parece mucho a la del primer día, ya nos focalizamos en el manejo de nuestro programa que nos va a acompañar a lo largo de todo nuestro proyecto: el clone manager. 
Tres de vosotros ya los tenéis en vuestros portátiles y estáis encargados de pasarlo a los demás que no pudieron asistir así como de reuniros con ellos y realizar los ejercicios que se irán proponiendo desde este blog. Deberíamos de ser capaces de transmitirles todo lo que aprendimos y se debatió el pasado Jueves. Seguro que podemos!!!
Todos tenéis en vuestros portátiles una carpeta que se llamaba Copiar 1 (que contiene la carpeta clonemanager8 para instalar el programa, que simplemente hay que abrir el ejecutable: CmSuite8.exe en el que aparecerá la imagen de trabajo del programa:


A partir de ahí deberemos de practicar las distintas funciones que ejecutamos…
Para manejar el programa habrá que darle un click a “close”. Y darle a abrir Inicialmente sobre la carpeta Problema 1. Abriendo la secuencia que pone primera: 16SrRNA-1 (una secuencia de nucleótidos que nos servirá de ejemplo para entender cómo funciona este programa) abrir también las demás carpetas, A, B, … F)
A partir de aquí os queda “recordar” muchas de las cosas que llevamos a cabo:
- Visualizar una secuencia determinada (open).
- Cambiar la visualización a doble hebra (format). 
- Realizar una copia inversa (Operations: Process molecule: inverse…).
Entender la “direccionalidad” del ADN (que es el extremo 5’ y el extremo 3’). Entender que es la inversa de una cadena de DNA. Entender que, aunque solo tengamos una hebra, “siempre hay dos”.
Para ello usaremos las herramientas Align and Compare entre las secuencias de la carpeta (de la A a la F) y entenderemos sus parecidos y/o diferencias. Os animo a que las practiquéis en casa y las recordéis con vuestros compañeros que no pudieron venir.



En una próxima entrada, Cuando nos aseguremos que todos tenemos en nuestros ordenadores el programa Clone Manager, seguiremos recordando todo lo que hicimos!!!!
(Os anticipo…  qué es un gen? Cómo se analiza??)

Aupa Team…. Ya estamos acercándonos a nuestro objetivo!!!!

jueves, 28 de noviembre de 2019

¡¡¡Vaya primer día!!!


Y llego nuestro primer gran día. ¡¡¡Y vaya día!!! Ufffff!!!!
No todos los días se comienza todo un PROYECTO DE INVESTIGACIÓN. Si nos fijamos detenidamente, ya no somos los mismos que entramos al centro (la Estación Experimental del Zaidín) mirad la foto. En breve será como nuestro segundo IES… o al menos eso esperamos.
El pasado Miercoles 27, supimos lo que vamos a hacer en estos “largos” 4-6 meses. Largos??? Nada de eso, se pasarán a la velocidad del rayo. Y de hecho ya empiezo a notar que nos falta tiempo para todo lo que tenemos que investigar analizar, etc… .
De vuestras preguntas, vuestras caras, vuestras miradas deduzco que el proyecto no os ha defraudado de momento y que con un poco de suerte, mi ayuda y vuestro trabajo tendrá un buen fin. Yo no tengo ninguna duda. Hemos tenido suerte somos un Buen equipo. En breve deberemos ponernos un nombre y quizás un grito de guerra. Se aceptan sugerencias…
Porque, como os he dicho y si mirais la presentación del primer día (ya en recursos) lo que vamos a hacer es encontrar en genomas de bacterias los famosos CRISPR. Que ya SABEMOS LO QUE SIGNIFICAN, o no???
Son  los “Clustered Regularly Interspaced Short Palindromic Repeats” que ya debemos de empezar a pronunciarlo correctamente.
Bueno sin más una nueva cita nos espera. En ella empezaremos a dar nuestros primeros “pasos” en el proyecto donde aprenderemos a “pescar” nuevos y no descritos sistemas CRISPR.
Aupa Team!!!!


viernes, 22 de noviembre de 2019

Bienvenida

Estimados jóvenes, padres y madres, coordinadores y profesores;
En primer lugar, darles la bienvenida al proyecto PIIISA 2019-2020 titulado ¿El genoma de mi bacteria posee elementos CRISPR?” que se desarrollará en la Estación Experimental del Zaidín - Consejo Superior de Investigaciones Científicas. Este es un nuevo proyecto PIIISA que desarrollo como investigador, en el que se plantean nuevos desafíos. Desafíos que entroncan directamente con una nueva línea de investigación que venimos desarrollando en el grupo desde hace unos 3-4 años (Caracterización de nuevos sistemas CRISPR basados en su asociación a unos genes denominados Reverso transcriptasas; cuenta de Twitter: @TORO_LAB).


Al final de este proyecto deberíamos convertirnos en unos expertos en la denominada tecnología CRISPR. Os animo a que buceéis en el significado de estas siglas, puestas de moda recientemente incluso en periódicos. EL OBJETIVO PLANTEADO EN ESTE PROYECTO, aún por definir del todo, se entronca en tecnologías que se están aplicando en distintos laboratorios del mundo interesados en el descubrimiento de nuevas variedades de la denominada “edición génica a la carta" con multiples aplicaciones (Medicina, Agricultura, etc.).
Todos nuestros avances y resultados los iremos plasmando en este blog en el cual también tendremos recursos, enlaces, etc. Todo aquello que nos permita hacer de este proyecto una experiencia de la que nos sintamos muy orgullosos y de la que hagamos partícipes a todo nuestro entorno: nuestros padres, nuestros compañeros de clase, profesores, amigos... Esta forma de dar a conocer nuestros resultados no es nueva; ejemplo de ello lo tenéis en los blog de proyectos anteriores, que podéis visitar en estos enlaces Descubriendo nuevas especies a través de la bioinformática; ¿Dónde mutan los genes?; Testing mutagens¿Cómo mutan los genes?
En la sección de recursos se encuentran los artículos correspondientes a los trabajos realizados en las ediciones precedentes. En ellos se puede comprobar como nuestros proyectos anteriores han sido todos factibles y llevados a buen puerto, como así ha de ser en este nuevo.
Y ya nada más que pedir vuestra colaboración también en este, nuestro blog. Pero no solo con vuestras aportaciones, sino con las de todos aquellos a los que podamos hacer partícipes de nuestras investigaciones. Seguro que ellos también pueden añadir comentarios interesantes que dinamicen nuestro blog. 
Y por ahora nada más. Ánimo, entre todos vamos a hacer un gran proyecto.

Dr Francisco Martinez-Abarca
Estacion Experimental del Zaidin - CSIC
Department of Microbiology
C/ Profesor Albareda n 1
18008 Granada
Spain

Entradas más visitadas